Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_100433 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Pancreatic Cancer | ICD-10 | Malignant neoplasm of Pancreas, unspecified (C25.9) |
DBLink | Link to database | PMID | 29620241 |
Experimental Method | |||
Sample Type | Tissues | Comparison | 20 pancreatic cancer tissues and corresponding paracancerous tissues |
Method for Estimation | Microarrays | PCR Details | |
Primers (Experimented) | Forward CTTACCCATTCAGCCCATTCC ReverseCGTGGCAAGGCTCTTTCTTCT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Guo, S, Xu, X, Ouyang, Y, Wang, Y, Yang, J, Yin, L, Ge, J, Wang, H (2018). Microarray expression profile analysis of circular RNAs in pancreatic cancer. Mol Med Rep, 17, 6:7661-7671. |